Skip to main content

pMAL-c5X-Darpin E_01
(Plasmid #66996)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66996 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMAL-c5X
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 5677
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    malE-Darpin E_01
  • Species
    Synthetic
  • Promoter tac
  • Tags / Fusion Proteins
    • malE-Factor Xa (N terminal on backbone)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAL-c5X-Darpin E_01 was a gift from Ashutosh Chilkoti (Addgene plasmid # 66996 ; http://n2t.net/addgene:66996 ; RRID:Addgene_66996)
  • For your References section:

    Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins. Tang NC, Chilkoti A. Nat Mater. 2016 Jan 4. doi: 10.1038/nmat4521. 10.1038/nmat4521 PubMed 26726995