pMAL-c5X-ELP[V5A2G3-60]
(Plasmid
#67009)
-
PurposeExpresses malE-ELP[V5A2G3-60] in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMAL-c5X
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 5677
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemalE-ELP[V5A2G3-60]
-
SpeciesSynthetic
- Promoter tac
-
Tags
/ Fusion Proteins
- malE-Factor Xa (N terminal on backbone)
- His6 (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAL-c5X-ELP[V5A2G3-60] was a gift from Ashutosh Chilkoti (Addgene plasmid # 67009 ; http://n2t.net/addgene:67009 ; RRID:Addgene_67009) -
For your References section:
Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins. Tang NC, Chilkoti A. Nat Mater. 2016 Jan 4. doi: 10.1038/nmat4521. 10.1038/nmat4521 PubMed 26726995