Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pp32ΔCT
(Plasmid #67241)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67241 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pProEX HTb
  • Backbone manufacturer
    life technology
  • Backbone size w/o insert (bp) 4779
  • Total vector size (bp) 5226
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pp32
  • Alt name
    Anp32a
  • Alt name
    acidic nuclear phosphoprotein 32 family member A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    447
  • Mutation
    contains amino acid residues 1-149
  • GenBank ID
    NM_006305
  • Entrez Gene
    ANP32A (a.k.a. C15orf1, HPPCn, I1PP2A, LANP, MAPM, PHAP1, PHAPI, PP32)
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer ATCTTCTCTCATCCGCCAAAACAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pp32ΔCT was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ; http://n2t.net/addgene:67241 ; RRID:Addgene_67241)
  • For your References section:

    The crystal structure of the tumor suppressor protein pp32 (Anp32a): structural insights into Anp32 family of proteins. Huyton T, Wolberger C. Protein Sci. 2007 Jul;16(7):1308-15. Epub 2007 Jun 13. 10.1110/ps.072803507 PubMed 17567741