-
PurposeConjugally transferable red recombinogenic plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepKD46
-
Vector typeRed Recombinase
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)SM10lambdapir
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametraJ, cat, oriT
- Promoter cat gene promoter from PGNS-BAC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (destroyed during cloning)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer CGTCTACTCCGTTACAA
- 3′ sequencing primer AGTATGATCTCAATGGTTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Conjugally transferable red recombinase vector pMJH46
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJH46 was a gift from Mark Liles (Addgene plasmid # 67272 ; http://n2t.net/addgene:67272 ; RRID:Addgene_67272) -
For your References section:
Genome modifications and cloning using a conjugally transferable recombineering system. Hossain MJ, Thurlow CM, Sun D, Nasrin S, Liles MR. Biotechnol Rep (Amst). 2015 Aug 28;8:24-35. doi: 10.1016/j.btre.2015.08.005. eCollection 2015 Dec. 10.1016/j.btre.2015.08.005 PubMed 28352570