-
PurposeConjugally transferable Flp recombinase plasmid for unmarked mutagenesis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRham-flp-tetA
-
Backbone manufacturerHossain el al (Mark Liles lab)
- Backbone size w/o insert (bp) 3699
- Total vector size (bp) 5813
-
Vector typeFlp recombinase plasmid, temperature sensitive
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)E. coli SM10lambdapir
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametetA, flp, repA101, oriR101
-
Insert Size (bp)5813
- Promoter tetA promoter of plasmid pACYC184 origin
-
Tag
/ Fusion Protein
- His-SUMO (flp) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaAI (destroyed during cloning)
- 3′ cloning site AlwNI (destroyed during cloning)
- 5′ sequencing primer CGCATTCACAGTTCTCCGCAAG
- 3′ sequencing primer CGAATCATCGGAAGAAGCAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
conjugally transferable flp plasmid for unmarked mutagenesis pCMT-flp
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMT-flp was a gift from Mark Liles (Addgene plasmid # 67274 ; http://n2t.net/addgene:67274 ; RRID:Addgene_67274) -
For your References section:
Genome modifications and cloning using a conjugally transferable recombineering system. Hossain MJ, Thurlow CM, Sun D, Nasrin S, Liles MR. Biotechnol Rep (Amst). 2015 Aug 28;8:24-35. doi: 10.1016/j.btre.2015.08.005. eCollection 2015 Dec. 10.1016/j.btre.2015.08.005 PubMed 28352570