Transposon-for RMCE_Sleeping Beauty_LIR-CAG-Frt-red(katushka)-P2A-Puro-F3-PA-RIR
(Plasmid
#67275)
-
PurposeFor sleeping beauty transposition and establishment of an recombinase mediated cassette exchange docking site. To make RMCE in cell line instead of flp in cell lines
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAmp
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 7000
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepuromycin resistant gene
-
SpeciesSynthetic
-
Insert Size (bp)700
- Promoter CAG
-
Tag
/ Fusion Protein
- linked to red flouresent protein gene (katushka) (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site ClaI (unknown if destroyed)
- 5′ sequencing primer tgggcttgtactcggtcata
- 3′ sequencing primer aacagatggaaggcctcctg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Transposon-for RMCE_Sleeping Beauty_LIR-CAG-Frt-red(katushka)-P2A-Puro-F3-PA-RIR was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 67275 ; http://n2t.net/addgene:67275 ; RRID:Addgene_67275) -
For your References section:
Recombinase-Mediated Cassette Exchange (RMCE)-in Reporter Cell Lines as an Alternative to the Flp-in System. Callesen MM, Berthelsen MF, Lund S, Fuchtbauer AC, Fuchtbauer EM, Jakobsen JE. PLoS One. 2016 Aug 19;11(8):e0161471. doi: 10.1371/journal.pone.0161471. eCollection 2016. 10.1371/journal.pone.0161471 PubMed 27541869