Skip to main content

Transposon-for RMCE_Sleeping Beauty_LIR-CAG-Frt-red(katushka)-P2A-Puro-F3-PA-RIR
(Plasmid #67275)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67275 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Amp
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 7000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    puromycin resistant gene
  • Species
    Synthetic
  • Insert Size (bp)
    700
  • Promoter CAG
  • Tag / Fusion Protein
    • linked to red flouresent protein gene (katushka) (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site ClaI (unknown if destroyed)
  • 5′ sequencing primer tgggcttgtactcggtcata
  • 3′ sequencing primer aacagatggaaggcctcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Transposon-for RMCE_Sleeping Beauty_LIR-CAG-Frt-red(katushka)-P2A-Puro-F3-PA-RIR was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 67275 ; http://n2t.net/addgene:67275 ; RRID:Addgene_67275)
  • For your References section:

    Recombinase-Mediated Cassette Exchange (RMCE)-in Reporter Cell Lines as an Alternative to the Flp-in System. Callesen MM, Berthelsen MF, Lund S, Fuchtbauer AC, Fuchtbauer EM, Jakobsen JE. PLoS One. 2016 Aug 19;11(8):e0161471. doi: 10.1371/journal.pone.0161471. eCollection 2016. 10.1371/journal.pone.0161471 PubMed 27541869