-
Purpose4hydroxytamoxifen inducible FlpO recombinase controlled by intestine specific promoter (Villin). FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon context
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67278 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAmp
- Total vector size (bp) 17000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVillin-mTQ2-P2A-FlpO-ERT2
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)11999
- Promoter Villin
-
Tag
/ Fusion Protein
- mTQ2, linked to FlpO through an P2A ribosomal skipping site (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (unknown if destroyed)
- 3′ cloning site Bstz17I (unknown if destroyed)
- 5′ sequencing primer tagaggttggactacagtgg
- 3′ sequencing primer tcttgatgtcgctgaacctg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Villinpromoter-blue-FlpOERT2 was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 67278 ; http://n2t.net/addgene:67278 ; RRID:Addgene_67278) -
For your References section:
A genetically inducible porcine model of intestinal cancer. Callesen MM, Arnadottir SS, Lyskjaer I, Orntoft MW, Hoyer S, Dagnaes-Hansen F, Liu Y, Li R, Callesen H, Rasmussen MH, Berthelsen MF, Thomsen MK, Schweiger PJ, Jensen KB, Laurberg S, Orntoft TF, Elverlov-Jakobsen JE, Andersen CL. Mol Oncol. 2017 Nov;11(11):1616-1629. doi: 10.1002/1878-0261.12136. Epub 2017 Oct 10. 10.1002/1878-0261.12136 PubMed 28881081