Skip to main content

AAV-CMV-SOD2-2A-Catalase-WPRE
(Plasmid #67635)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67635 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV-MCS8
  • Backbone manufacturer
    Jeng-Shin Lee, Harvard University
  • Total vector size (bp) 8516
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SOD-2A-Catalase
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2361
  • Mutation
    Deleted the Peroxisome Targeting Signal from Catalase and added the mitochondrial targeting sequence to the N-terminus of catalase
  • Entrez Gene
    Sod2 (a.k.a. MnSOD, Sod-2)
  • Entrez Gene
    Cat (a.k.a. 2210418N07, Ca, Cas, Cas-1, Cas1, Cs-, Cs-1)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tattggctcatgtccaacat
  • 3′ sequencing primer aatttcacaaataaagcact
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CMV-SOD2-2A-Catalase-WPRE was a gift from Connie Cepko (Addgene plasmid # 67635 ; http://n2t.net/addgene:67635 ; RRID:Addgene_67635)
  • For your References section:

    NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage. Xiong W, MacColl Garfinkel AE, Li Y, Benowitz LI, Cepko CL. J Clin Invest. 2015 Apr;125(4):1433-45. doi: 10.1172/JCI79735. Epub 2015 Mar 23. 10.1172/JCI79735 PubMed 25798616