Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-C1-Cep123 (CCDC123/Cep89)
(Plasmid #67787)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67787 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Total vector size (bp) 7068
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cep123
  • Alt name
    CCDC123
  • Alt name
    Cep89
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2352
  • GenBank ID
    NM_032816
  • Entrez Gene
    CEP89 (a.k.a. CCDC123, CEP123)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal I (not destroyed)
  • 3′ cloning site BamH I (not destroyed)
  • 5′ sequencing primer GFP 3' Fw (TTCGTGACCGCCGCCGGGATCA)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-Cep123 (CCDC123/Cep89) was a gift from Michel Bornens (Addgene plasmid # 67787 ; http://n2t.net/addgene:67787 ; RRID:Addgene_67787)
  • For your References section:

    Primary ciliogenesis requires the distal appendage component Cep123. Sillibourne JE, Hurbain I, Grand-Perret T, Goud B, Tran P, Bornens M. Biol Open. 2013 Apr 9;2(6):535-45. doi: 10.1242/bio.20134457. Print 2013 Jun 15. BIO20134457 [pii] PubMed 23789104