Skip to main content

PNCA-luciferase
(Plasmid #67793)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67793 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNCA
  • Backbone size w/o insert (bp) 8000
  • Modifications to backbone
    GFP cassette in pNCA-GFP was replaced with the firefly luciferase gene via BamHI/XhoI restriction sites.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MMLV-LTR-firefly luciferase
  • Species
    Moloney murine leukemia virus

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Amp-R (ATAATACCGCGCCACATAGC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PNCA-luciferase was a gift from Stephen Goff (Addgene plasmid # 67793 ; http://n2t.net/addgene:67793 ; RRID:Addgene_67793)
  • For your References section:

    Postentry restriction of Mason-Pfizer monkey virus in mouse cells. Wang GZ, Goff SP. J Virol. 2015 Mar;89(5):2813-9. doi: 10.1128/JVI.03051-14. Epub 2014 Dec 24. 10.1128/JVI.03051-14 PubMed 25540373