pGL3-MMLV-LTR-Luc
(Plasmid
#67831)
-
PurposeExpression of luciferase under the control of MMLV viral LTRs
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3-Basic Vector
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMMLV-LTR + primer binding site
-
Tag
/ Fusion Protein
- luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pGL3-R (CTTGGCATTCCGGTACTGTT) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-MMLV-LTR-Luc was a gift from Stephen Goff (Addgene plasmid # 67831 ; http://n2t.net/addgene:67831 ; RRID:Addgene_67831) -
For your References section:
Postentry restriction of Mason-Pfizer monkey virus in mouse cells. Wang GZ, Goff SP. J Virol. 2015 Mar;89(5):2813-9. doi: 10.1128/JVI.03051-14. Epub 2014 Dec 24. 10.1128/JVI.03051-14 PubMed 25540373