-
Purpose4-hydroxytamoxifen inducible ER:ras fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67844 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLNCX2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6100
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameER1a H-RasG12V fusion
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)1600
-
MutationG525R renders the HBD largely insensitive to 17ß‐estradiol at concentrations less than 100 nM but does not abrogate its responsiveness to the synthetic ligand 4‐hydroxytamoxifen
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byViola Borgdorff, David Beach's Lab @ QMUL
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid encodes murine ER1a fused to human H-RasG12V.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLNCX2 ER:ras was a gift from Masashi Narita (Addgene plasmid # 67844 ; http://n2t.net/addgene:67844 ; RRID:Addgene_67844) -
For your References section:
Autophagy mediates the mitotic senescence transition. Young AR, Narita M, Ferreira M, Kirschner K, Sadaie M, Darot JF, Tavare S, Arakawa S, Shimizu S, Watt FM, Narita M. Genes Dev. 2009 Apr 1;23(7):798-803. doi: 10.1101/gad.519709. Epub 2009 Mar 11. 10.1101/gad.519709 PubMed 19279323