pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W
(Plasmid
#67975)
-
PurposeCRISPR gRNA expression vector with an improved scaffold and puro/ZsG markers
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 67975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKLV2 lentiviral vector
- Backbone size w/o insert (bp) 5783
- Total vector size (bp) 8648
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6gRNA cassette, PGKpuro2AZsG cassette, WPRE
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)2898
-
MutationDeleted BbsI site within WPRE
- Promoter human U6 promoter, mouse PGK promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CATAATAGCAACAGACATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W was a gift from Kosuke Yusa (Addgene plasmid # 67975 ; http://n2t.net/addgene:67975 ; RRID:Addgene_67975) -
For your References section:
A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Tzelepis K, Koike-Yusa H, De Braekeleer E, Li Y, Metzakopian E, Dovey OM, Mupo A, Grinkevich V, Li M, Mazan M, Gozdecka M, Ohnishi S, Cooper J, Patel M, McKerrell T, Chen B, Domingues AF, Gallipoli P, Teichmann S, Ponstingl H, McDermott U, Saez-Rodriguez J, Huntly BJ, Iorio F, Pina C, Vassiliou GS, Yusa K. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. 10.1016/j.celrep.2016.09.079 PubMed 27760321