-
Purposeexpress EGFP-tagged FKBP for heterodimerization with FRB in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68058 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepC4M-F2E (now pHet-Mem1)
-
Backbone manufacturerARIAD (now Clontech
- Backbone size w/o insert (bp) 5726
- Total vector size (bp) 6395
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Speciesjellyfish
-
Insert Size (bp)717
-
GenBank IDU55763.1
- Promoter CMV
-
Tags
/ Fusion Proteins
- 2xFKBP (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CMVf: CGC AAA TGG GCG GTA GGC GTG
- 3′ sequencing primer Bglob-intron-R: TTTGCCCCCTCCATATAACA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC4M-F2E-GFP-FKBP was a gift from Richard Youle (Addgene plasmid # 68058 ; http://n2t.net/addgene:68058 ; RRID:Addgene_68058) -
For your References section:
p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy; VDAC1 is dispensable for both. Narendra D, Kane LA, Hauser DN, Fearnley IM, Youle RJ. Autophagy. 2010 Nov;6(8):1090-106. 13426 [pii] PubMed 20890124