Skip to main content

pDGB1omega1_SF (GB0158)
(Plasmid #68242)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68242 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDGB1_omega1
  • Backbone manufacturer
    self-made; derived from pGreenII generated at the JIC
  • Vector type
    Synthetic Biology ; Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Solanum lycopersicum intergenic region
  • Insert Size (bp)
    150
  • Mutation
    BsaI and BsmBI sites removed

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer caacctctcgggcttctgga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

insert can be released with BsaI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDGB1omega1_SF (GB0158) was a gift from Diego Orzaez (Addgene plasmid # 68242 ; http://n2t.net/addgene:68242 ; RRID:Addgene_68242)
  • For your References section:

    GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Physiol. 2013 Jul;162(3):1618-31. 10.1104/pp.113.217661 PubMed 23669743