pTXB3-Flag PLK1 T210D
(Plasmid
#68272)
-
Purposebacterial expression of Plk1 T210D mutant
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTXB1
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6700
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePLK1
-
Alt namepolo-like kinase 1
-
SpeciesH. sapiens (human)
-
MutationT210D
-
Entrez GenePLK1 (a.k.a. PLK, STPK13)
- Promoter T7
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- Mxe intein/chitin binding domain (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7
- 3′ sequencing primer MxeInt-R AGGGCAACTAGTGCATCTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use BL21 cells for protein production
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTXB3-Flag PLK1 T210D was a gift from Stefano Ferrari (Addgene plasmid # 68272 ; http://n2t.net/addgene:68272 ; RRID:Addgene_68272)