Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-CREB
(Plasmid #68550)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68550 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4650
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CREB
  • Alt name
    cAMP response element binding protein
  • Species
    R. norvegicus (rat)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pCAX-F CAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CREB was a gift from Eric Nestler (Addgene plasmid # 68550 ; http://n2t.net/addgene:68550 ; RRID:Addgene_68550)
  • For your References section:

    cAMP response element binding protein phosphorylation in nucleus accumbens underlies sustained recovery of sensorimotor gating following repeated D(2)-like receptor agonist treatment in rats. Berger AK, Green T, Siegel SJ, Nestler EJ, Hammer RP Jr. Biol Psychiatry. 2011 Feb 1;69(3):288-94. doi: 10.1016/j.biopsych.2010.08.032. Epub 2010 Oct 30. 10.1016/j.biopsych.2010.08.032 PubMed 21035786