-
PurposeSplit GFP assay
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQCXIP
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin, Blasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebsr
-
Alt nameBlasticidin S-resistance gene
-
SpeciesBacillus cereus
-
Tags
/ Fusion Proteins
- GFP11 (C terminal on insert)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer tttccgggccctcacattgccaaa
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Overall this plasmid contains bsr-GFP11-ires-puromycin resistance gene. GFP11 covers the 11th strand of GFP and the sequence is ctgcagcgcgatcacatggtcctgcacgagtacgtgaacgccgccgggatcact.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQCXIP-BSR-GFP11 was a gift from Yutaka Hata (Addgene plasmid # 68716 ; http://n2t.net/addgene:68716 ; RRID:Addgene_68716) -
For your References section:
A new cell-based assay to evaluate myogenesis in mouse myoblast C2C12 cells. Kodaka M, Yang Z, Nakagawa K, Maruyama J, Xu X, Sarkar A, Ichimura A, Nasu Y, Ozawa T, Iwasa H, Ishigami-Yuasa M, Ito S, Kagechika H, Hata Y. Exp Cell Res. 2015 Aug 15;336(2):171-81. doi: 10.1016/j.yexcr.2015.06.015. Epub 2015 Jun 24. 10.1016/j.yexcr.2015.06.015 PubMed 26116467