pAD/CMV/V5-DEST-Cdc42-2G
(Plasmid
#68812)
-
PurposeFRET-based biosensor reporting on endogenous Cdc42 activation (for Adenovirus production)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAD/CMV/V5-DEST
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 36686
- Total vector size (bp) 37347
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCdc42 activation reporter
-
SpeciesSynthetic
-
Insert Size (bp)2670
- Promoter CMV
-
Tags
/ Fusion Proteins
- His (N terminal on insert)
- Myc (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAD/CMV/V5-DEST-Cdc42-2G was a gift from Olivier Pertz (Addgene plasmid # 68812 ; http://n2t.net/addgene:68812 ; RRID:Addgene_68812) -
For your References section:
Spatio-temporal co-ordination of RhoA, Rac1 and Cdc42 activation during prototypical edge protrusion and retraction dynamics. Martin K, Reimann A, Fritz RD, Ryu H, Jeon NL, Pertz O. Sci Rep. 2016 Feb 25;6:21901. doi: 10.1038/srep21901. 10.1038/srep21901 PubMed 26912264