pNeoXTR f0
(Plasmid
#69157)
-
Purposemouse targeting vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBS
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 7775
-
Modifications to backbonesee pNeoXTR f0.gb file
-
Vector typeMouse Targeting
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameDTA
-
Speciesdiptheria
-
Insert Size (bp)984
- Promoter PGK
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer tctaccgggtaggggaggcg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNeoR
-
Insert Size (bp)804
- Promoter PGK
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer tctaccgggtaggggaggcg
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameGFP
-
Alt namegreen fluorescent protein
-
Insert Size (bp)720
- Promoter none
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer ttacttgtacagctcgtcca
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameAmpR
-
Insert Size (bp)861
- Promoter Amp promoter
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer tctaccgggtaggggaggcg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNeoXTR f0 was a gift from David Feldser (Addgene plasmid # 69157 ; http://n2t.net/addgene:69157 ; RRID:Addgene_69157) -
For your References section:
Recombinase-based conditional and reversible gene regulation via XTR alleles. Robles-Oteiza C, Taylor S, Yates T, Cicchini M, Lauderback B, Cashman CR, Burds AA, Winslow MM, Jacks T, Feldser DM. Nat Commun. 2015 Nov 5;6:8783. doi: 10.1038/ncomms9783. 10.1038/ncomms9783 PubMed 26537451