pCSDest2-SpCas9-MT2-NLS-3XHA-NLS
(Plasmid
#69222)
-
PurposeExpresses R1333S mutant SpCas9 in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCSDest2-SpCas9-NLS-3XHA-NLS
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9
-
SpeciesS. pyogenes
-
MutationArginine 1333 is changed to Serine
-
Tag
/ Fusion Protein
- NLS-3XHA-NLS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site SgrAI (destroyed during cloning)
- 5′ sequencing primer CACAGGGATAAGCCCATCAG
- 3′ sequencing primer T3 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSDest2-SpCas9-MT2-NLS-3XHA-NLS was a gift from Scot Wolfe (Addgene plasmid # 69222 ; http://n2t.net/addgene:69222 ; RRID:Addgene_69222) -
For your References section:
DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Bolukbasi MF, Gupta A, Oikemus S, Derr AG, Garber M, Brodsky MH, Zhu LJ, Wolfe SA. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. 10.1038/nmeth.3624 PubMed 26480473