Skip to main content

pCSDest2-SpCas9-MT3-NLS-3XHA-NLS
(Plasmid #69223)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69223 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCSDest2-SpCas9-NLS-3XHA-NLS
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Species
    S. pyogenes
  • Mutation
    Arginine 1335 is changed to Lysine
  • Tag / Fusion Protein
    • NLS-3XHA-NLS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SgrAI (not destroyed)
  • 5′ sequencing primer CACAGGGATAAGCCCATCAG
  • 3′ sequencing primer T3
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSDest2-SpCas9-MT3-NLS-3XHA-NLS was a gift from Scot Wolfe (Addgene plasmid # 69223 ; http://n2t.net/addgene:69223 ; RRID:Addgene_69223)
  • For your References section:

    DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Bolukbasi MF, Gupta A, Oikemus S, Derr AG, Garber M, Brodsky MH, Zhu LJ, Wolfe SA. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. 10.1038/nmeth.3624 PubMed 26480473