-
Purposeluciferase reporter in lentivirus backbone
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRRLSIN.cPPT.PGK/GFP.WPRE
- Backbone size w/o insert (bp) 7384
- Total vector size (bp) 7809
-
Modifications to backbonehPGK and GFP were removed by digestion with XhoI and SalI and then replaced with Luciferase
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLuciferase
-
SpeciesP. pyralis
-
Insert Size (bp)1653
-
GenBank IDM15077.1
- Promoter none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer atcgatcacgagactagcc
- 3′ sequencing primer AAGGAAGGTCCGCTGGATTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is designed for insertion of investigator's promoter of interest to permit lentiviral transduction of the luciferase reporter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRLSIN.cPPTLuciferase.WPRE was a gift from Stephen Tapscott (Addgene plasmid # 69251 ; http://n2t.net/addgene:69251 ; RRID:Addgene_69251)