pRRLSIN.cPPT.RFPL4b.Luciferase.WPRE
(Plasmid
#69252)
-
PurposeLuciferase in lentivirus backbone to report Dux4 activation of RFPL4b promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRRLSIN.cPPT.luciferase.WPRE
- Backbone size w/o insert (bp) 7809
- Total vector size (bp) 8515
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRFPL4b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)684
-
Entrez GeneRFPL4B (a.k.a. RNF211)
- Promoter RFPL4b
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer ATCGATCACGAGACTAGCC
- 3′ sequencing primer AAGGAAGGTCCGCTGGATTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRLSIN.cPPT.RFPL4b.Luciferase.WPRE was a gift from Stephen Tapscott (Addgene plasmid # 69252 ; http://n2t.net/addgene:69252 ; RRID:Addgene_69252)