pSFFV-Cx43
(Plasmid
#69442)
-
Purposemammalian expression of rat Cx43
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSFFV
-
Backbone manufacturerFuhlbrigge, et al 1998, PMID 3261013
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCx43
-
Alt nameGja1
-
SpeciesR. norvegicus (rat)
-
Entrez GeneGja1 (a.k.a. Cx43, Cxnk1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer SFFV-F attgattgactgcccacctc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was provided by Joseph Stains (University of Maryland School of Medicine), who received it from Thomas Steinberg (Washington University).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSFFV-Cx43 was a gift from Richard Veenstra (Addgene plasmid # 69442 ; http://n2t.net/addgene:69442 ; RRID:Addgene_69442) -
For your References section:
Selectivity of connexin-specific gap junctions does not correlate with channel conductance. Veenstra RD, Wang HZ, Beblo DA, Chilton MG, Harris AL, Beyer EC, Brink PR. Circ Res. 1995 Dec;77(6):1156-65. PubMed 7586229