Skip to main content
Addgene
Open Menu

CAG-DDdCas9VP192-T2A-EGFP-ires-puro
(Plasmid #69534)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69534 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 69534-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 69534-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    PyCAG
  • Total vector size (bp) 12561
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DD-dCas9VP192-T2A-EGFP
  • Insert Size (bp)
    6138
  • Promoter CAG
  • Tags / Fusion Proteins
    • DHFR Destabilised Domain (N terminal on insert)
    • C-term T2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCas9 Mutated from pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A), Addgene Plasmid #42335; DHFR cloned from pBMN DHFR(DD)-YFP, Addgene Plasmid #29325

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-DDdCas9VP192-T2A-EGFP-ires-puro was a gift from Timo Otonkoski (Addgene plasmid # 69534 ; http://n2t.net/addgene:69534 ; RRID:Addgene_69534)

  • For your References section:

    Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Balboa D, Weltner J, Eurola S, Trokovic R, Wartiovaara K, Otonkoski T. Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001. 10.1016/j.stemcr.2015.08.001 PubMed 26352799
Related items:
Commonly requested with: