pBS-L1PA13ACHmneo
(Plasmid #69613)

• Purpose: Expresses a neomycin tagged codon optimized L1PA13A
• Depositing Lab: Astrid Roy-Engel
• Publication: pBS-LINE1 plasmids (unpublished)

Backbone

• Vector backbone: pBluescript
• Backbone size w/o insert (bp): 3530
• Total vector size (bp): 11338
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418) ; G418 detects retrotransposition not the plasmid

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Standard E.coli strains can be used.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: L1PA13A
• Alt name: LINE-1 PA13A subfamily
• Species: H. sapiens (human)
• Insert Size (bp): 7797
• Promoter: CMV
• Tag / Fusion Protein:
  • mneo retrotransposition cassette

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AGGCGTGTACGGTGGGAGGTCTA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The ORF1 and ORF2 of the codon optimized L1PA13A element were commercially synthetically generated and then cloned into the parental pBS-L1PA1CHmneo by swapping the two ORFs.