pX330-mitf
(Plasmid
#69801)
-
PurposeUsed to make mitf knockout porcine cell line
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx330 (Addgene 42230)
- Backbone size w/o insert (bp) 8506
- Total vector size (bp) 8526
-
Modifications to backboneThe R1 sgRNA genome targeting sequence was cloned into the pX330 vector
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemitf-sgRNA
-
SpeciesPorcine
-
Insert Size (bp)20
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSpCas9
-
SpeciesSynthetic
-
Insert Size (bp)4101
- Promoter Chicken Beta-Actin
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer pCBhProF (5' agggatggttggttggtggg 3')
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
the pX330 vector, created by the laboratory of Dr. Feng Zhang and obtained from Addgene (Plasmid 42230), was used. The R1 sgRNA genome targeting sequence was cloned into the pX330 vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-mitf was a gift from Jianguo Zhao (Addgene plasmid # 69801 ; http://n2t.net/addgene:69801 ; RRID:Addgene_69801) -
For your References section:
Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs. Wang X, Zhou J, Cao C, Huang J, Hai T, Wang Y, Zheng Q, Zhang H, Qin G, Miao X, Wang H, Cao S, Zhou Q, Zhao J. Sci Rep. 2015 Aug 21;5:13348. doi: 10.1038/srep13348. 10.1038/srep13348 PubMed 26293209