Skip to main content

pLenti-CaMKIIa-SpyTag-C1C2-mCherry
(Plasmid #69833)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69833 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-CamKIIa
  • Backbone size w/o insert (bp) 9252
  • Total vector size (bp) 11112
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpyTag-C1C2
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
    1860
  • Mutation
    Inserted SpyTag after the signal peptide of C1C2.
  • Promoter CamKIIa
  • Tags / Fusion Proteins
    • Trafficking signal
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTGGATGCTGACGAAGGCTC
  • 3′ sequencing primer AAAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CaMKIIa-SpyTag-C1C2-mCherry was a gift from Viviana Gradinaru (Addgene plasmid # 69833 ; http://n2t.net/addgene:69833 ; RRID:Addgene_69833)
  • For your References section:

    Genetically Encoded Spy Peptide Fusion System to Detect Plasma Membrane-Localized Proteins In Vivo. Bedbrook CN, Kato M, Ravindra Kumar S, Lakshmanan A, Nath RD, Sun F, Sternberg PW, Arnold FH, Gradinaru V. Chem Biol. 2015 Aug 20;22(8):1108-21. doi: 10.1016/j.chembiol.2015.06.020. Epub 2015 Jul 23. 10.1016/j.chembiol.2015.06.020 PubMed 26211362