pGEMHEZFCNGA5
(Plasmid
#69861)
-
Purposeoocyte expression vector containing ZFCNGA5
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEMHE
-
Backbone manufacturerunknown
- Backbone size w/o insert (bp) 3022
-
Vector typeXenopus oocyte expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZFCNGA5
-
Alt nameCNGA5
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)2022
-
Mutationnone
-
Entrez Genecnga5
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer T7 forward
- 3′ sequencing primer pGEMHE/R1 GTAGCTTAGAGACTCCATTCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: This plasmid has an S132P amino acid residue substitution introduced via PCR, but this residue change is not thought to have any effect on ZFCNGA5 physiology or function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHEZFCNGA5 was a gift from Gary Matthews (Addgene plasmid # 69861 ; http://n2t.net/addgene:69861 ; RRID:Addgene_69861) -
For your References section:
Characterization of a novel cyclic nucleotide-gated channel from zebrafish brain. Tetreault ML, Henry D, Horrigan DM, Matthews G, Zimmerman AL. Biochem Biophys Res Commun. 2006 Sep 22;348(2):441-9. Epub 2006 Jul 28. 10.1016/j.bbrc.2006.07.074 PubMed 16887101
Map uploaded by the depositor.
