Skip to main content

pAAV:cTNT::Luciferase
(Plasmid #69915)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69915 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV2/9.cTnT.PI.EGFP.RBG
  • Backbone manufacturer
    Penn Vector Core
  • Backbone size w/o insert (bp) 4405
  • Total vector size (bp) 6047
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    The plasmid will easily get mutated if bacterial cultured too long. Using SmaI to do a diagnose digestion is recommended.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase
  • Species
    Firefly
  • Insert Size (bp)
    1653
  • GenBank ID
    Nuleotide> U47295
  • Promoter Chicken cardiac troponin T

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCAATAGAAACTGGGCTTGTC
  • 3′ sequencing primer CCAGAAGTCAGATGCTCAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The luciferase gene was PCR amplified from pGL basic vector (Promega) .
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains chicken cardiac tromonin T promoter. When packaged into AAV9 virus using the AAV 2/9 Rep/Cap plasmid, the AAV9:cTNT.Luciferease virus will easily transduce the neonatal mouse. This virus does not work in vitro cultured cardiomyocytes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV:cTNT::Luciferase was a gift from William Pu (Addgene plasmid # 69915 ; http://n2t.net/addgene:69915 ; RRID:Addgene_69915)
  • For your References section:

    Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Lin Z, von Gise A, Zhou P, Gu F, Ma Q, Jiang J, Yau AL, Buck JN, Gouin KA, van Gorp PR, Zhou B, Chen J, Seidman JG, Wang DZ, Pu WT. Circ Res. 2014 Jul 18;115(3):354-63. doi: 10.1161/CIRCRESAHA.115.303632. Epub 2014 May 15. 10.1161/CIRCRESAHA.115.303632 PubMed 24833660