-
PurposeUsed to package AAV9:cTNT::luciferase. Specifically transduce cardiomyocytes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 69915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2/9.cTnT.PI.EGFP.RBG
-
Backbone manufacturerPenn Vector Core
- Backbone size w/o insert (bp) 4405
- Total vector size (bp) 6047
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Growth instructionsThe plasmid will easily get mutated if bacterial cultured too long. Using SmaI to do a diagnose digestion is recommended.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
SpeciesFirefly
-
Insert Size (bp)1653
-
GenBank IDNuleotide> U47295
- Promoter Chicken cardiac troponin T
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCAATAGAAACTGGGCTTGTC
- 3′ sequencing primer CCAGAAGTCAGATGCTCAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe luciferase gene was PCR amplified from pGL basic vector (Promega) .
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
This plasmid contains chicken cardiac tromonin T promoter. When packaged into AAV9 virus using the AAV 2/9 Rep/Cap plasmid, the AAV9:cTNT.Luciferease virus will easily transduce the neonatal mouse. This virus does not work in vitro cultured cardiomyocytes.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV:cTNT::Luciferase was a gift from William Pu (Addgene plasmid # 69915 ; http://n2t.net/addgene:69915 ; RRID:Addgene_69915) -
For your References section:
Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Lin Z, von Gise A, Zhou P, Gu F, Ma Q, Jiang J, Yau AL, Buck JN, Gouin KA, van Gorp PR, Zhou B, Chen J, Seidman JG, Wang DZ, Pu WT. Circ Res. 2014 Jul 18;115(3):354-63. doi: 10.1161/CIRCRESAHA.115.303632. Epub 2014 May 15. 10.1161/CIRCRESAHA.115.303632 PubMed 24833660