pMY200
(Plasmid
#69946)
-
Purpose(Empty Backbone) Agrobacterium-based transformation vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMY200
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer LB-F1 gtggtgtaaacaaattgacgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PCR was used to amplify a fragment containing the left T-DNA border from PBht2. Two primers were designed as follows:
TRDNAS: CAAAgTTggCgTATAACATAgT, downstream of SacII site in pBht2.
TLDNAAPmeI: ATTATAgTTTAAACATTCggCgTTAATTCAgTACA, upstream of T-border 5’ end contains PmeI site in pBht2.
2. Digested PCR product with PmeI and SacII, gel extraction followed by recovery of ~400 bp fragment, and pBht2 vector was digested with PmeI and SacII, gel extracted, followed by recovery of ~6 kb fragment. CIP dephosphatase treatment, ligated with PCR product, electroporate into E. coli.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMY200 was a gift from Mark Farman (Addgene plasmid # 69946 ; http://n2t.net/addgene:69946 ; RRID:Addgene_69946)