Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hJAM-A deltaCT pcDNA3.1
(Plasmid #70074)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70074 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 6500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Geneticin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    junctional adhesion molecule-A
  • Alt name
    JAM-A, JAM1, F11R
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    957
  • Mutation
    deleted C-terminal cytoplasmic tail (amino acids 261-299)
  • Entrez Gene
    F11R (a.k.a. CD321, JAM, JAM1, JAMA, JCAM, KAT, PAM-1)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGH Reverse: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Modified from full-length gene, which was cloned out of an NT2 cDNA library (Stratagene, La Jolla, CA)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hJAM-A deltaCT pcDNA3.1 was a gift from Terence Dermody (Addgene plasmid # 70074 ; http://n2t.net/addgene:70074 ; RRID:Addgene_70074)
  • For your References section:

    JAM-A-independent, antibody-mediated uptake of reovirus into cells leads to apoptosis. Danthi P, Hansberger MW, Campbell JA, Forrest JC, Dermody TS. J Virol. 2006 Feb;80(3):1261-70. 10.1128/JVI.80.3.1261-1270.2006 PubMed 16415003