pCS-TRE-FHDnd1-Ubc-rtTA-I2G
              
              
                (Plasmid
                
                #70076)
              
            
            
            
          - 
            Purpose2nd gen lentiviral vector. tet/dox controllable expression of FLAG-HA-tagged murine Dnd1 in mammalian cells
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70076 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneCS-TRE-mOKS-PRE-Ubc-rTTA-I2G
 - Backbone size w/o insert (bp) 11522
 - 
              Vector typeMammalian Expression, Lentiviral
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameDnd1
 - 
                  Alt namedead end homolog 1
 - 
                  Alt nameRBMS4
 - 
                  Alt nameDND microRNA-mediated repression inhibitor 1
 - 
                    SpeciesM. musculus (mouse)
 - 
                  Insert Size (bp)1203
 - 
                  MutationSilent mutations are introduced to escape from RNAi using pLKO.1-shDnd1-No1, 6, and 8
 - 
                    GenBank ID213236
 - 
                        Entrez GeneDnd1 (a.k.a. RBMS4, Ter)
 - Promoter Tet responsible promoter
 - 
    
        Tags
        / Fusion Proteins
    
- FLAG (N terminal on backbone)
 - HA (N terminal on backbone)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site EcoRI (not destroyed)
 - 3′ cloning site NheI (not destroyed)
 - 5′ sequencing primer LNCX AGCTCGTTTAGTGAACCGTCAGATC
 - 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Silent mutations are introduced to escape from RNAi using pLKO.1-shDnd1-No. 1,6, and 8 deposited in Addgene (plasmids #70058, 70067, and 70069).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pCS-TRE-FHDnd1-Ubc-rtTA-I2G was a gift from Thomas Tuschl (Addgene plasmid # 70076 ; http://n2t.net/addgene:70076 ; RRID:Addgene_70076) - 
                
For your References section:
DND1 maintains germline stem cells via recruitment of the CCR4-NOT complex to target mRNAs. Yamaji M, Jishage M, Meyer C, Suryawanshi H, Der E, Yamaji M, Garzia A, Morozov P, Manickavel S, McFarland HL, Roeder RG, Hafner M, Tuschl T. Nature. 2017 Mar 23;543(7646):568-572. doi: 10.1038/nature21690. Epub 2017 Mar 15. 10.1038/nature21690 PubMed 28297718