pLKO_HOXB13_#1
(Plasmid
#70093)
-
PurposeExpression of shRNA to human HOXB13, puromycin selection
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHOXB13
-
gRNA/shRNA sequenceCCCGTGCCTTATGGTTACTTT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_006361.5
-
Entrez GeneHOXB13 (a.k.a. HPC9, PSGD)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pLKO_forward
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBroad Institute
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Broad Institute Clone ID TRCN0000020845
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO_HOXB13_#1 was a gift from William Hahn (Addgene plasmid # 70093 ; http://n2t.net/addgene:70093 ; RRID:Addgene_70093) -
For your References section:
The androgen receptor cistrome is extensively reprogrammed in human prostate tumorigenesis. Pomerantz MM, Li F, Takeda DY, Lenci R, Chonkar A, Chabot M, Cejas P, Vazquez F, Cook J, Shivdasani RA, Bowden M, Lis R, Hahn WC, Kantoff PW, Brown M, Loda M, Long HW, Freedman ML. Nat Genet. 2015 Nov;47(11):1346-51. doi: 10.1038/ng.3419. Epub 2015 Oct 12. 10.1038/ng.3419 PubMed 26457646