pECFP-C1-rGAT
(Plasmid
#70108)
-
Purposemammalian expression of rat GAT with N terminal CFP fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70108 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepECFP-C1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAT
-
SpeciesR. norvegicus (rat)
-
Entrez GeneSlc6a1 (a.k.a. Gabt1, Gat1)
- Promoter CMV
-
Tag
/ Fusion Protein
- ECFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (destroyed during cloning)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer pEGFP-R: acctctacaaatgtggtatg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECFP-C1-rGAT was a gift from Harald Sitte (Addgene plasmid # 70108 ; http://n2t.net/addgene:70108 ; RRID:Addgene_70108) -
For your References section:
Mutations within an intramembrane leucine heptad repeat disrupt oligomer formation of the rat GABA transporter 1. Scholze P, Freissmuth M, Sitte HH. J Biol Chem. 2002 Nov 15;277(46):43682-90. Epub 2002 Sep 9. 10.1074/jbc.M205602200 PubMed 12223478