Skip to main content

pECFP-C1-rGAT
(Plasmid #70108)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70108 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pECFP-C1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GAT
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Slc6a1 (a.k.a. Gabt1, Gat1)
  • Promoter CMV
  • Tag / Fusion Protein
    • ECFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (destroyed during cloning)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer pEGFP-R: acctctacaaatgtggtatg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECFP-C1-rGAT was a gift from Harald Sitte (Addgene plasmid # 70108 ; http://n2t.net/addgene:70108 ; RRID:Addgene_70108)
  • For your References section:

    Mutations within an intramembrane leucine heptad repeat disrupt oligomer formation of the rat GABA transporter 1. Scholze P, Freissmuth M, Sitte HH. J Biol Chem. 2002 Nov 15;277(46):43682-90. Epub 2002 Sep 9. 10.1074/jbc.M205602200 PubMed 12223478