Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pENV8(WT)-GFPuv
(Plasmid #70127)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70127 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBR327
  • Backbone size w/o insert (bp) 3273
  • Total vector size (bp) 4597
  • Modifications to backbone
    insertion of riboswitch/GFP reporter in place of the tetracycline resistance gene
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    wild type environmental cobalamin riboswitch sequence (env8)
  • Species
    metagenome
  • Insert Size (bp)
    250
  • Promoter tac
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GTCGTCCCTATCTGCTGCCCTAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The GFPuv reporter came from pGFPUV from Clonetech.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENV8(WT)-GFPuv was a gift from Robert Batey (Addgene plasmid # 70127 ; http://n2t.net/addgene:70127 ; RRID:Addgene_70127)
  • For your References section:

    B12 cofactors directly stabilize an mRNA regulatory switch. Johnson JE Jr, Reyes FE, Polaski JT, Batey RT. Nature. 2012 Dec 6;492(7427):133-7. doi: 10.1038/nature11607. Epub 2012 Oct 14. 10.1038/nature11607 PubMed 23064232