pENV8(WT)-GFPuv
(Plasmid
#70127)
-
PurposeCobalamin riboswitch reporter vector for use in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70127 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBR327
- Backbone size w/o insert (bp) 3273
- Total vector size (bp) 4597
-
Modifications to backboneinsertion of riboswitch/GFP reporter in place of the tetracycline resistance gene
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namewild type environmental cobalamin riboswitch sequence (env8)
-
Speciesmetagenome
-
Insert Size (bp)250
- Promoter tac
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GTCGTCCCTATCTGCTGCCCTAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GFPuv reporter came from pGFPUV from Clonetech.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENV8(WT)-GFPuv was a gift from Robert Batey (Addgene plasmid # 70127 ; http://n2t.net/addgene:70127 ; RRID:Addgene_70127) -
For your References section:
B12 cofactors directly stabilize an mRNA regulatory switch. Johnson JE Jr, Reyes FE, Polaski JT, Batey RT. Nature. 2012 Dec 6;492(7427):133-7. doi: 10.1038/nature11607. Epub 2012 Oct 14. 10.1038/nature11607 PubMed 23064232