Skip to main content
Addgene

pmCherry-C1-MKLP1
(Plasmid #70154)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70154 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmCherry-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4722
  • Total vector size (bp) 7274
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MKLP1
  • Alt name
    kinesin family member 23
  • Alt name
    KIF23
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2574
  • Entrez Gene
    KIF23 (a.k.a. CDA3, CDAIII, CDAN3, CDAN3A, CHO1, KNSL5, MKLP-1, MKLP1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer Cherry-F ccccgtaatgcagaagaaga
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that there are two silent mutations at position 2673 and 4203. The former is an artificial SalI site and the latter a polymorphism (I think). They also have Gly (GGG) artificially inserted between the starting methionine and the lysine 2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-C1-MKLP1 was a gift from Masanori Mishima (Addgene plasmid # 70154 ; http://n2t.net/addgene:70154 ; RRID:Addgene_70154)
  • For your References section:

    ARF6 GTPase protects the post-mitotic midbody from 14-3-3-mediated disintegration. Joseph N, Hutterer A, Poser I, Mishima M. EMBO J. 2012 May 30;31(11):2604-14. doi: 10.1038/emboj.2012.139. Epub 2012 May 11. 10.1038/emboj.2012.139 PubMed 22580824