-
PurposeMammalian expression of hsOPA1 isoform 7
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70179 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-puro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6300
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehsOPA1 isoform 7
-
Alt nameOptic atrophy 1 protein
-
Alt nameKIAA0567
-
Alt nameDYNAMIN-LIKE 120-KD PROTEIN, MITOCHONDRIAL
-
SpeciesH. sapiens (human)
-
GenBank IDNM_130836.2
-
Entrez GeneOPA1 (a.k.a. BERHS, MGM1, MTDPS14, NPG, NTG, largeG)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site HpaI (unknown if destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OPA1-isoform7 was a gift from David Chan (Addgene plasmid # 70179 ; http://n2t.net/addgene:70179 ; RRID:Addgene_70179) -
For your References section:
OPA1 processing controls mitochondrial fusion and is regulated by mRNA splicing, membrane potential, and Yme1L. Song Z, Chen H, Fiket M, Alexander C, Chan DC. J Cell Biol. 2007 Aug 27;178(5):749-55. Epub 2007 Aug 20. 10.1083/jcb.200704110 PubMed 17709429