-
PurposeExpresses GFP11x7-mCherry-α-tubulin in insect cells. 5 a. a. linker lengths.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACUH
-
Backbone manufacturerYuh-Nung Jan lab
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP11x7-mCherry-α-tubulin
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)2538
-
Tags
/ Fusion Proteins
- GFP11x7 (N terminal on insert)
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCAACTGCAACTACTGA
- 3′ sequencing primer GCTTTAAATCTCTGTAGGTAGTTTGTC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACUH-GFP11x7-mCherry-α-tubulin was a gift from Bo Huang (Addgene plasmid # 70218 ; http://n2t.net/addgene:70218 ; RRID:Addgene_70218) -
For your References section:
Versatile protein tagging in cells with split fluorescent protein. Kamiyama D, Sekine S, Barsi-Rhyne B, Hu J, Chen B, Gilbert LA, Ishikawa H, Leonetti MD, Marshall WF, Weissman JS, Huang B. Nat Commun. 2016 Mar 18;7:11046. doi: 10.1038/ncomms11046. 10.1038/ncomms11046 PubMed 26988139