-
PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV-tetO
-
Backbone manufacturerHochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
- Backbone size w/o insert (bp) 8370
- Total vector size (bp) 9119
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesDiscosoma sp.
-
Insert Size (bp)750
- Promoter tetO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
- 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-tetO-mCherry was a gift from Hubert Schorle (Addgene plasmid # 70273 ; http://n2t.net/addgene:70273 ; RRID:Addgene_70273) -
For your References section:
Direct Induction of Trophoblast Stem Cells from Murine Fibroblasts. Kubaczka C, Senner CE, Cierlitza M, Arauzo-Bravo MJ, Kuckenberg P, Peitz M, Hemberger M, Schorle H. Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005. 10.1016/j.stem.2015.08.005 PubMed 26412560