pRL692
(Plasmid #70284)

• Purpose: Tn5-based plasmid for transposition in Synechococcus sp. strain PCC 7942
• Depositing Lab: Peter Wolk
• Publication: Koksharova et al J Bacteriol. 2002 Oct;184(19):5524-8.

Backbone

• Vector backbone: unknown
• Total vector size (bp): 7738
• Vector type: Bacterial Expression
• Selectable markers: Erythromycin for cyanobacteria

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin and Streptomycin, 50 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Transposon Tn5-692

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CAT-F (GTTTGTGATGGCTTCCATGTC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Tn5 derivative Tn5-692 (in plasmid pRL692; GenBank accession no. AF424805) contains a pMB1 oriV; and bears mutations (Zhou, et al. 1998 J. Mol. Biol. 276:913–925) that increase its rate of transposition ca. 100-fold relative to that of Tn5-1058 (Wolk, et al. 1991. Proc. Natl. Acad. Sci. USA 88:5355–5359), providing large numbers of transposon mutants. The erythromycin-resistance gene came from Horinouchi and Weisblum (J. Bacteriol. 150: 804-814, 1982) and the streptomycin-spectinomycin gene came from the Ω-fragment described by Prentki and Krisch (Gene 29, 303-313, 1984) and was purchased as an EcoRI fragment from Amersham.

NOTE--Because Tn5-692 appears able to transpose repeatedly, the user is cautioned not to delay storing strains whose phenotype is of interest.

Additional references:
Miyagishima S-y, Wolk CP, Osteryoung KW (2005) Identification of cyanobacterial cell division genes by comparative and mutational analyses. Mol Microbiol 56: 126-143