-
Purposebacterial expression of human DNA Polymerase beta (POLB)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQE-30
-
Backbone manufacturerQiagen
- Backbone size w/o insert (bp) 3461
- Total vector size (bp) 4444
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePOLB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1010
-
MutationR333L
-
GenBank IDNM_002690
-
Entrez GenePOLB
- Promoter T5/lac operon
-
Tag
/ Fusion Protein
- 6x His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGGATAACAATTTCACACAG
- 3′ sequencing primer GTTCTGAGGTCATTACTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA was received from Samuel H. Wilson's lab (Beard et al., 1996, J. Biol. Chem. 271, 12141–12144 )
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE30-hPolB was a gift from Primo Schaer (Addgene plasmid # 70761 ; http://n2t.net/addgene:70761 ; RRID:Addgene_70761) -
For your References section:
3CAPS - a structural AP-site analogue as a tool to investigate DNA base excision repair. Schuermann D, Scheidegger SP, Weber AR, Bjoras M, Leumann CJ, Schar P. Nucleic Acids Res. 2016 Jan 4. pii: gkv1520. 10.1093/nar/gkv1520 PubMed 26733580