- 
            PurposeAn improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Cre inducible expression (double floxed inversed ORF)
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
- 
          SerotypeSelect serotype for details See details about
 - 
          PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
 - 
          How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
 - Addgene will quickly confirm that we can produce a high-quality prep for you.
 - Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
 - Receive your prep in 6–9 weeks after the MTA is approved by your organization.
 - Learn more about our Packaged on Request Service.
 
 
Backbone
- 
            Vector backbonepAAV
 - Backbone size w/o insert (bp) 5601
 - Total vector size (bp) 8007
 - 
              Vector typeMammalian Expression, AAV
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberHigh Copy
 
Gene/Insert 1
- 
                Gene/Insert nameChannelrhodopsin-2
 - 
                  Alt nameChR2, iChloC
 - 
                    SpeciesSynthetic; Chlamydomonas
 - 
                  Insert Size (bp)927
 - 
                  MutationE83Q,E90R,E101S,D156N,T159C
 - Promoter EF1a
 
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
 - 5′ cloning site KpnI (not destroyed)
 - 3′ cloning site NheI (not destroyed)
 - 5′ sequencing primer GGGATTCTCCTCCACGTCACCGC
 - 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
 
Gene/Insert 2
- 
                Gene/Insert namered fluorescent protein
 - 
                  Alt namedsRed
 - 
                    SpeciesDiscoma sp.
 - Promoter EF1a
 
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
 - 5′ cloning site AscI (not destroyed)
 - 3′ cloning site BamHI (not destroyed)
 - 5′ sequencing primer gagtttggatcttggttc
 - 3′ sequencing primer GGCAGAGGAAGTCTTCTAACAT (Common Sequencing Primers)
 
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byChR originally from P.Hegemann, HU-Berlin Germany tDimer originally form R.Tsien USD USA
 - 
            Articles Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pAAV EF1a DIO iChloC 2A dsRed was a gift from Thomas Oertner (Addgene plasmid # 70762 ; http://n2t.net/addgene:70762 ; RRID:Addgene_70762) - 
                
For your References section:
An improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Wietek J, Beltramo R, Scanziani M, Hegemann P, Oertner TG, Simon Wiegert J. Sci Rep. 2015 Oct 7;5:14807. doi: 10.1038/srep14807. 10.1038/srep14807 PubMed 26443033