Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW-GFP-CtIP
(Plasmid #71109)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71109 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    David Root; Addgene plasmid #41393
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CtlP
  • Species
    H. sapiens (human)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

siRNA resistant construct. Custom CtlP siRNA (Dharmacon) sequence: GCUAAAACAGGAACGAAUC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-GFP-CtIP was a gift from Daniel Durocher (Addgene plasmid # 71109 ; http://n2t.net/addgene:71109 ; RRID:Addgene_71109)
  • For your References section:

    A mechanism for the suppression of homologous recombination in G1 cells. Orthwein A, Noordermeer SM, Wilson MD, Landry S, Enchev RI, Sherker A, Munro M, Pinder J, Salsman J, Dellaire G, Xia B, Peter M, Durocher D. Nature. 2015 Dec 9. doi: 10.1038/nature16142. 10.1038/nature16142 PubMed 26649820