pRS416-Gal4-dCas9-VP64
(Plasmid
#71128)
-
PurposeThis plasmid contains a Cas9 Activator for yeast. The activator is about 1.2-1.8 X more potent than just dCas9-VP64 fusion in yeast. It is on a single copy CEN/ARS plasmid with Ura marker, pRS416.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS416
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 10203
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGal4-dCas9-VP64
-
Alt nameGal4 Activator domain, dCas9, VP64 activator dormain.
-
SpeciesS. cerevisiae (budding yeast), Synthetic; S pyogenes Cas9, S cerevisiae Gal4, Viral/ VP64
-
Insert Size (bp)4725
- Promoter Tef1
-
Tag
/ Fusion Protein
- NLS n-terminal, N terminal Gal4 Activator domain, C terminal VP64
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcacacaggaaacagctatgaccatg
- 3′ sequencing primer GTTGTAAAACGACGGCCAGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCas9 + promoter and terminator was obtained from DiCarlo et al 2013 from addgene https://www.addgene.org/43802/ . I created the activator version by introducing the D10A and H840A mutations to make dCas9 and then fusing VP64 and S cerevisiae Gal4 activator domains.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS416-Gal4-dCas9-VP64 was a gift from Ronald Davis (Addgene plasmid # 71128 ; http://n2t.net/addgene:71128 ; RRID:Addgene_71128) -
For your References section:
Dissecting the Genetic Basis of a Complex cis-Regulatory Adaptation. Naranjo S, Smith JD, Artieri CG, Zhang M, Zhou Y, Palmer ME, Fraser HB. PLoS Genet. 2015 Dec 29;11(12):e1005751. doi: 10.1371/journal.pgen.1005751. eCollection 2015 Dec. PGENETICS-D-15-02089 [pii] PubMed 26713447