Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRS416-Gal4-dCas9-VP64
(Plasmid #71128)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71128 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS416
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 10203
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gal4-dCas9-VP64
  • Alt name
    Gal4 Activator domain, dCas9, VP64 activator dormain.
  • Species
    S. cerevisiae (budding yeast), Synthetic; S pyogenes Cas9, S cerevisiae Gal4, Viral/ VP64
  • Insert Size (bp)
    4725
  • Promoter Tef1
  • Tag / Fusion Protein
    • NLS n-terminal, N terminal Gal4 Activator domain, C terminal VP64

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcacacaggaaacagctatgaccatg
  • 3′ sequencing primer GTTGTAAAACGACGGCCAGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cas9 + promoter and terminator was obtained from DiCarlo et al 2013 from addgene https://www.addgene.org/43802/ . I created the activator version by introducing the D10A and H840A mutations to make dCas9 and then fusing VP64 and S cerevisiae Gal4 activator domains.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS416-Gal4-dCas9-VP64 was a gift from Ronald Davis (Addgene plasmid # 71128 ; http://n2t.net/addgene:71128 ; RRID:Addgene_71128)
  • For your References section:

    Dissecting the Genetic Basis of a Complex cis-Regulatory Adaptation. Naranjo S, Smith JD, Artieri CG, Zhang M, Zhou Y, Palmer ME, Fraser HB. PLoS Genet. 2015 Dec 29;11(12):e1005751. doi: 10.1371/journal.pgen.1005751. eCollection 2015 Dec. PGENETICS-D-15-02089 [pii] PubMed 26713447