Skip to main content

pJBL2807
(Plasmid #71203)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71203 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Custom
  • Backbone size w/o insert (bp) 2149
  • Total vector size (bp) 2217
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AD1 Antisense
  • Species
    Synthetic
  • Insert Size (bp)
    68
  • Promoter BBa_J23119

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer aaccattattatcatgacattaac
  • 3′ sequencing primer ttaccgcctttgagtgagctgataccgctcgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJBL2807 was a gift from Julius Lucks (Addgene plasmid # 71203 ; http://n2t.net/addgene:71203 ; RRID:Addgene_71203)
  • For your References section:

    Creating small transcription activating RNAs. Chappell J, Takahashi MK, Lucks JB. Nat Chem Biol. 2015 Mar;11(3):214-20. doi: 10.1038/nchembio.1737. Epub 2015 Feb 2. 10.1038/nchembio.1737 PubMed 25643173