Skip to main content

pAP1-3
(Plasmid #71258)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71258 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGM55
  • Backbone manufacturer
    Cockerill lab, Addgene plasmid 71249
  • Total vector size (bp) 6305
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3 copies of an AP-1 site from the human Stromelysin-1 gene
  • Alt name
    matrix metallopeptidase 3
  • Species
    H. sapiens (human)
  • Entrez Gene
    MMP3 (a.k.a. CHDS6, MMP-3, SL-1, STMY, STMY1, STR1)
  • Promoter GM-CSF minimal
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer unknown
  • 3′ sequencing primer LucNRev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloned as 3 copies of an oligonucleotide duplex with complementary overhanging BglII ends: AGATCTGGATCACCCGCAGCTTGACTCATCCTTGCAGATCT

Reference for AP-1 site = Cockerill PN, Shannon MF, Bert AG, Ryan GR and Vadas MA. The GM-CSF/IL3 locus is regulated by an inducible cyclosporin A sensitive enhancer. Proc.Natl.Acad.Sci. USA 90, 2466-2470, 1993.

JM109 are the cells used by the author for pXPG and its derivatives.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAP1-3 was a gift from Peter Cockerill (Addgene plasmid # 71258 ; http://n2t.net/addgene:71258 ; RRID:Addgene_71258)